235
235
Jan 24, 2013
01/13
by
WBAL
tv
eye 235
favorite 0
quote 0
. >> this is a government who has not had his ears cropped -- a doberman who has not had his ears cropped. people do it because they want to make the dogs look more attentive. this is a lovely, beautiful dog. >> you have some products you want to talk about. >> i do. this is the latest and greatest new products you will hear about this year. it is significantly different. if i was going to recommend a product, i would say do not go to the super park -- supermarket or on line. talk to your vet about this. it is a better product. it affects the flea before it passes away. paralyzes it. the consequence is, if you have an animal with fleet allergies, they stopped pitching almost -- with fully -- flea allergies, they stop teaching almost immediately because the fleet is paralyzed. >> how long can you stay out without getting frostbite? >> that is a good question. the rule of thumb if you do not know, maybe no longer than you could stay out. when the temperatures are in the teens, that is when you have to be very careful. they can freeze very quickly. without having to say three minutes or five
. >> this is a government who has not had his ears cropped -- a doberman who has not had his ears cropped. people do it because they want to make the dogs look more attentive. this is a lovely, beautiful dog. >> you have some products you want to talk about. >> i do. this is the latest and greatest new products you will hear about this year. it is significantly different. if i was going to recommend a product, i would say do not go to the super park -- supermarket or on line....
85
85
Jan 23, 2013
01/13
by
KQED
tv
eye 85
favorite 0
quote 0
perhaps, some of the ultra- orthodox religious parties and recent governments. after nationwide protests last year, the high cost of living in israel, it was a major issue in this election. >> some of the reason they have lost power is the economic situation in israel. there is what happened here last summer. you may see a bit of a change. if you look in the diplomatic area. unfortunately, it is my opinion -- i am optimistic. >> this will concern the israeli allies who have already warned that time is running out for peace with the palestinians. this man says he is keen to have talks, but there is little expectation of progress on the ground. is really politics are always complicated. religious parties will fight any attempt to exclude them from government, but a coalition that is too ideologically why it could also prove unworkable. bbc news, jerusalem. >> for more on the results in israel, i am joined with -- but a man he served in the middle east and is a special assistant to president obama. he currently is a counselor at the washington institute. how weeken
perhaps, some of the ultra- orthodox religious parties and recent governments. after nationwide protests last year, the high cost of living in israel, it was a major issue in this election. >> some of the reason they have lost power is the economic situation in israel. there is what happened here last summer. you may see a bit of a change. if you look in the diplomatic area. unfortunately, it is my opinion -- i am optimistic. >> this will concern the israeli allies who have already...
97
97
Jan 24, 2013
01/13
by
KQED
tv
eye 97
favorite 0
quote 0
the government soldiers have been accused today of going on a rampage against civilians. we found this body on the front lines, an islamist fighter, one of dozens of locals allegedly killed by their own army. >> there is evidence of killing, rape against civilians. the fear is that as the french clear the way, the army which is thirsty for revenge will commit crimes against other people because of the color of their skin and they have been allied to the enemies. >> rare footage of the rebels that seized timbuktu. many are lighter skinned tribesmen. there are fears of an ethnic bloodbath if and when the ancient city is recaptured. an army hospital, this has been a key meeting year for the soldiers defeated by the islamist militants. they all terrorists, the sergeant tells me. now, we will win. it is that a victory depends on this outside military help. the british foreign office expressed deep concern about the allegation against their army. british troops are on their way here very soon to help train the military and improve their discipline and prevent abuses but it is a
the government soldiers have been accused today of going on a rampage against civilians. we found this body on the front lines, an islamist fighter, one of dozens of locals allegedly killed by their own army. >> there is evidence of killing, rape against civilians. the fear is that as the french clear the way, the army which is thirsty for revenge will commit crimes against other people because of the color of their skin and they have been allied to the enemies. >> rare footage of...
82
82
Jan 24, 2013
01/13
by
WUSA
tv
eye 82
favorite 0
quote 0
government. they say it disproportion natalie affects black students. the group rallied yesterday outside city hall. donald temple is one of the attorneys involved in this lawsuit. >> the leaders of the city who occupy this building should take steps to ensure that there is equality, fairness, and accountability in the decision- making process. >> the d.c. school chancellor says she wants to close the 15 schools because they're basically half empty. many of the schools are in anacostia where the enrollment is going down in the public schools and growing in the charter schools. the group suing the city says many of the parents are choosing these charter schools because the district is not putting enough resources into their kids' public schools. >>> 21 degrees. so, yes, it is cold and wet outside. but just be thankful you don't live in the midwest or new england. a water main break in columbus, ohio turn add road into a sheet of ice. it's so cold in vermont, the lakes are steaming. the temperature in northern maine dropped to 36 degrees below zero. yes.
government. they say it disproportion natalie affects black students. the group rallied yesterday outside city hall. donald temple is one of the attorneys involved in this lawsuit. >> the leaders of the city who occupy this building should take steps to ensure that there is equality, fairness, and accountability in the decision- making process. >> the d.c. school chancellor says she wants to close the 15 schools because they're basically half empty. many of the schools are in...
58
58
Jan 27, 2013
01/13
by
WUSA
tv
eye 58
favorite 0
quote 0
is government -- does government have the tools including the legal authorities as well as the organizational structure and the money, et cetera, to wage war in cyberspace? terrorism is another one. we've just seen these events in mali, algeria and so forth. it's not done. it's spreading in more places around the world. again do we have the legal authorities and are we able to act swiftly enough and do we have the military capability to go in and deal with the situation like the consulate in benghazi or the gas plant in algeria? i think those are some of the questions we'll be looking at in the months to come. >> do you think -- one of the things the president has said in his address was the necessity for the united states to whenever possible to engage to build alliances and to have conflict as a last resort. is he on the right track strategically do you think given the budgetary constraints right now? >> i think more and more of what we must do is work by, with and through others kind of the traditional definition of what special forces do. on the other hand, there are reports that the fren
is government -- does government have the tools including the legal authorities as well as the organizational structure and the money, et cetera, to wage war in cyberspace? terrorism is another one. we've just seen these events in mali, algeria and so forth. it's not done. it's spreading in more places around the world. again do we have the legal authorities and are we able to act swiftly enough and do we have the military capability to go in and deal with the situation like the consulate in...
133
133
Jan 23, 2013
01/13
by
FOXNEWSW
tv
eye 133
favorite 0
quote 0
government in advance. asked by representative tom cot top are you distressed that the suspect was released? she answered no, i'm not distressed. i can tell you talking to intelligence officials and others involved in the investigation that there are plenty of people distressed he was released and we didn't have full warning but ansar al-sharia in tunisia did have warning. >> bret: she says that the f.b.i. director mueller told by tunisian he is under surveillance. >> monitored was the word she used. >> bret: but may or may not still be in tunis and seems unclear. >> we wouldn't pressure the tunisian government to allow us access to him because we were worried that the ricketting new tunisian government would collapse if we applied pressure but they are so sophisticated and capable they can monitor this i go we released. also, we monitored guantanamo detainees who have been released. many of them have gone on to commit additional acts of terror. the other big question, i think, though, is where was hillary
government in advance. asked by representative tom cot top are you distressed that the suspect was released? she answered no, i'm not distressed. i can tell you talking to intelligence officials and others involved in the investigation that there are plenty of people distressed he was released and we didn't have full warning but ansar al-sharia in tunisia did have warning. >> bret: she says that the f.b.i. director mueller told by tunisian he is under surveillance. >> monitored was...
97
97
Jan 24, 2013
01/13
by
FBC
tv
eye 97
favorite 0
quote 0
gerri: it is government spending that just won't die. albrecht on a little-known program that congress can't seem to cut in 60 seconds. ♪ ♪ gerri: when it comes to cutting the purse strings, nobody, nobody is worst in congress. i mean nobody. case in point, an obscure program called the christopher columbus foundation, the program offering cash reward for research in the fields of agricultural science and biology. even runs a competition for middle schoolers to use science to solve local problems. they send the kids, the winners to walt disney will for a week. sounds nice except for the fact that there are other federal programs that do the exact same thing like one run by the army that rewards innovative metals coolest with a trip to washington. look, not only is the program redundant and something probably last to the private sector, but it is the government's spending no licking killed. have tried to get rid of the 450,000 of program, but nobody can make it happen. three republicans have introduced legislation to end it , no dice.
gerri: it is government spending that just won't die. albrecht on a little-known program that congress can't seem to cut in 60 seconds. ♪ ♪ gerri: when it comes to cutting the purse strings, nobody, nobody is worst in congress. i mean nobody. case in point, an obscure program called the christopher columbus foundation, the program offering cash reward for research in the fields of agricultural science and biology. even runs a competition for middle schoolers to use science to solve local...
79
79
Jan 24, 2013
01/13
by
CURRENT
tv
eye 79
favorite 0
quote 0
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns, pistols and even assault rifles, some rusted, some brand new. la county sheriff deputy stacked them. the weapons will be catatatatatatatatatatatatatatatatatatatatatatatatatatatatatat and good luck. ♪ uh, i'm in a timeout because apparently riding the dog like it's a small horse is frowned upon in this establishment! luckily though, ya know, i conceal this bad boy underneath my blanket just so i can get on e-trade. check my investment portfolio, research stocks... wait, why are you taking... oh, i see...solitary. just a man and his thoughts. and a smartphone... with an e-trade app. ♪ nob
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns,...
2,661
2.7K
Jan 29, 2013
01/13
by
COM
tv
eye 2,661
favorite 0
quote 0
maybe you put a lid on this sexual misbehavior by again have some sort of standard or code that governs how the military conducts itself. some kind of a military code of conduct, if you will. but even that won't address the biggest hazard ladies present our fighting men. >> if you had to go to a rest room, pee in a bottle inches from the comrade next to you. if you develop dysentery you had to pooh in a bag inches from your comrade's face. introducing women into that environment can be really traumatic and humiliating. >> jon: i'm going to jump in here. first of all, i know a lot of german businessmen who would pay good money for that. secondly, you're in a war zone. you're in a war zone and your big worry is dying of embarrassment? and by the way, i think i figured something out here. if men are going to be poohing inches from their female comrade's face, i believe that solves your eros problem. eros is irrational but it's not [bleep] crazy. all right. our own samantha bee explores this more in depth with this report >> reporter: last week defense secretary leon panetta made military h
maybe you put a lid on this sexual misbehavior by again have some sort of standard or code that governs how the military conducts itself. some kind of a military code of conduct, if you will. but even that won't address the biggest hazard ladies present our fighting men. >> if you had to go to a rest room, pee in a bottle inches from the comrade next to you. if you develop dysentery you had to pooh in a bag inches from your comrade's face. introducing women into that environment can be...
101
101
Jan 24, 2013
01/13
by
CURRENT
tv
eye 101
favorite 0
quote 0
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns, pistols and even assault rifles, some rusted, some brand new. la county sheriff deputy stacked them. the weapons will be cataloged and then destroyed. here a cheap, there a cheap, everywhere a cheap... you get it. so, what if instead of just a cheap choice you could make a smart choice? like, esurance for example. they were born online and built to save people money from the beginning. it's what they've always done. not just something they cheap about. that's insurance for the modern world. esurance. now backed by allstate. click or call. >> cenk: you know, we try to bring attention to peop
mark my words, they will shut the government down. they will do whatever they need to do. they will be as obstinate as humanly possible. they will sacrifice everything, the republicans will. the only thing they will not sacrifice are the bondholders who are their bosses. all right when we come back, a gun buy back in los angeles actually brought in rpgs rocket propelled grenades. is it a smart idea to do that or not? we'll talk to the guy running the program when we return. >> shotguns,...
184
184
Jan 24, 2013
01/13
by
CNNW
tv
eye 184
favorite 0
quote 0
didn't say much other than we're working with the tunisian government. one suspect was released. >> they say he's under observation. >> they weren't ready to bring charges yet. you know, anderson, here's the problem. the bad guys understand this. they are watching. there hasn't been anybody brought to justice. they understand very well the environment they are operating in. security services have melted away after the arab spring. borders are easy to cross. weapons are easily assessable. the bad guys have an advantage. the longer it takes to bring an investigation to a conclusion and hold people accountable suggests to the bad guys that they have a free operating environment and americans are at risk throughout that region. >> interesting. fran, appreciate it. >>> diane o'meara learned from a reporter she was the face of manti te'o's fake girlfriend. her stolen image is at the center of an entire hoax that changed the way some people see the star linebacker. she joins me live ahead. >>> a controversial new book explores the church's interest in hollywood
didn't say much other than we're working with the tunisian government. one suspect was released. >> they say he's under observation. >> they weren't ready to bring charges yet. you know, anderson, here's the problem. the bad guys understand this. they are watching. there hasn't been anybody brought to justice. they understand very well the environment they are operating in. security services have melted away after the arab spring. borders are easy to cross. weapons are easily...
170
170
Jan 24, 2013
01/13
by
KTVU
tv
eye 170
favorite 0
quote 0
. >> reporter: we're in front of city hall, where government business ends around 5:00. the lights remain on inside, because there's still work to be done. >> the niners are going to the super bowl. >> reporter: robert is a proud native san franciscan. the custodian considers city hall, his second home. >> i love the job. this is my second house. i live here eight hours a day, maybe more. >> reporter: he spent most nights here for the past 14 years. >> probably better than my own place. >> reporter: the 55-year-old is among the 50,000 city workers who may face a pay cut, when the current union contract expires next week. they say city administrators have considered cutting wages for jobs traditionally held by women and minorities. positions that pay 40,000, to $80,000 a year. >> we hear a lot about violence to women. this is a financial violence to women and minorities. >> reporter: saying there's no dollar amount attached to the proposed pay cut. the city says the cuts may apply only to new hires. if no agreement is reached by june 14, the matter goes to arbitration. >>
. >> reporter: we're in front of city hall, where government business ends around 5:00. the lights remain on inside, because there's still work to be done. >> the niners are going to the super bowl. >> reporter: robert is a proud native san franciscan. the custodian considers city hall, his second home. >> i love the job. this is my second house. i live here eight hours a day, maybe more. >> reporter: he spent most nights here for the past 14 years. >>...
99
99
Jan 24, 2013
01/13
by
WJZ
tv
eye 99
favorite 0
quote 0
the government soldiers have been accused today of going on a rampage against civilians. we found this body on the front lines, an islamist fighter, one of dozens of locals allegedly killed by their own army. >> there is evidence of killing, rape against civilians. the fear is that as the french clear the way, the army which is thirsty for revenge will commit crimes against other people because of the color of their skin and they have been allied to the enemies. >> rare footage of the rebels that seized timbuktu. many are lighter skinned tribesmen. there are fears of an ethnic bloodbath if and when the ancient city is recaptured. an army hospital this has been a key meeting year for the soldiers defeated by the islamist militants. they all terrorists, the sergeant tells me. now, we will win. it is that a victory depends on this outside military help. the british foreign office expressed deep concern about the allegation against their army. british troops are on their way here very soon to help train the military and improve their discipline and prevent abuses but it is al
the government soldiers have been accused today of going on a rampage against civilians. we found this body on the front lines, an islamist fighter, one of dozens of locals allegedly killed by their own army. >> there is evidence of killing, rape against civilians. the fear is that as the french clear the way, the army which is thirsty for revenge will commit crimes against other people because of the color of their skin and they have been allied to the enemies. >> rare footage of...
65
65
Jan 24, 2013
01/13
by
WTTG
tv
eye 65
favorite 0
quote 0
any time we get snow around here, there are some issues. >> the federal government taking action due to the snow that has fallen overnight as well. >> it is open today. you must contact your supervisor if you plan to take either unscheduled leave or telework. >> stafford county, virginia purpose schools are closed today. administrative offices will open at 10:00 this morning. >> so tucker barnes told us this was going to happen. he got it right. >> well, i like to think i got it right every time. >> but we want to give you your props. >> i appreciate it, wisdom. >> not a big deal. this is not a major storm by any means. looking at snow totals of 1/4 inch down to a little more than a couple of inches. the temperatures outside are very cold so, as mentioned yesterday, every flake has had a chance to stick to paved areas. we'll watch things continue to kind of wind down here in the next couple of hours. i think by 8:00 this morning, we should be down to just a few flurries. you can see there in the live picture we're still dealing with some snow showers across the area. temperature righ
any time we get snow around here, there are some issues. >> the federal government taking action due to the snow that has fallen overnight as well. >> it is open today. you must contact your supervisor if you plan to take either unscheduled leave or telework. >> stafford county, virginia purpose schools are closed today. administrative offices will open at 10:00 this morning. >> so tucker barnes told us this was going to happen. he got it right. >> well, i like to...
153
153
Jan 27, 2013
01/13
by
CNNW
tv
eye 153
favorite 0
quote 0
government by targeting this website. it contained a long warning threatening to release sensitive information about the department of justice in what it calls war heads, these are named after supreme court justices. you may never have browsed ussc.gov, but they said that there's a reason that they select method website, to target -- selected this website. earlier today, the fbi said they were aware of the cyber attack as soon as it happened and they are handling it as a criminal investigation. don? >> emily, thank you very much. anonymous, a hacker group has inserted itself into several news stories. they took a stand in a rape case that hit a small down in ohio, posting a video of one of the suspects and encouraging large scale protests. president obama will make a appearance with 60 minutes on the exit of hillary clinton. >> why did you want to do this together? a joint interview? >> the main thing is i wanted to have a chance to publically say thank you. because i think hillary will go down as one of the finest secret
government by targeting this website. it contained a long warning threatening to release sensitive information about the department of justice in what it calls war heads, these are named after supreme court justices. you may never have browsed ussc.gov, but they said that there's a reason that they select method website, to target -- selected this website. earlier today, the fbi said they were aware of the cyber attack as soon as it happened and they are handling it as a criminal investigation....
119
119
Jan 25, 2013
01/13
by
CURRENT
tv
eye 119
favorite 0
quote 0
and that is this fear that is eroding our capacity to have a democratic government. so we believe at network, if we work on the aspects of fear, where we break down fear by getting to know our neighbors by knowing that we're in this together, that really by exercising what jesus says about coming together, about two or three being gathered together, about all of us sharing the resources that we have, that if we come together in community fear will be lessened and in lessening fear then, we lessen the desire to use these weapons that are so horrific. >> john: sister, how dare you be so unpatriotic and talk about faith. the u.s. conference of bishops spoke forcefully in favor of addressing gun violence. only a few seconds left, but do you think that might move the hearts of some of our conservative catholic friends who routinely boast about how pro-life they are? >> i sincerely hope so. that they hear the message that pro-life is more than being probirth. it is guarding the lives of all people! and that our bishops have spoken forcefully on that. i don't hold out 100%
and that is this fear that is eroding our capacity to have a democratic government. so we believe at network, if we work on the aspects of fear, where we break down fear by getting to know our neighbors by knowing that we're in this together, that really by exercising what jesus says about coming together, about two or three being gathered together, about all of us sharing the resources that we have, that if we come together in community fear will be lessened and in lessening fear then, we...
147
147
Jan 25, 2013
01/13
by
CNNW
tv
eye 147
favorite 0
quote 0
we know little more about him today than when he took over the government for his father king jong-il. what what we do know, he's in his late 20s, spent some time in a swiss boarding school and he married the woman to his left on your screen. we have not seen her since these pictures came out. no idea if they're still married, if she's still on the scene. now uppermost in a lot of minds of the people, is this man calling the shots? is the military calling the shots? who exactly is in control and what does control mean in that country? this week kim's government unlived some very firy rhetoric, threats against the united nations and united states. and key ally south korea. the warning, more rocket tests and the latest one coming today, a warning to the south of, quote, strong physical counter measures, end quote, if the south helps to enforce new u.n. sanctions against the north, sanctions imposed after north korea's rocket launch last month. washington believes they're trying to develop missiles that could hit the united states, missiles that could one day possibly be armed with nucle
we know little more about him today than when he took over the government for his father king jong-il. what what we do know, he's in his late 20s, spent some time in a swiss boarding school and he married the woman to his left on your screen. we have not seen her since these pictures came out. no idea if they're still married, if she's still on the scene. now uppermost in a lot of minds of the people, is this man calling the shots? is the military calling the shots? who exactly is in control...
177
177
Jan 25, 2013
01/13
by
KQED
tv
eye 177
favorite 0
quote 0
it's near a key military air base and government ministries. meanwhile, president bashar al- assad was seen publicly for the first time in two weeks. state t.v. showed him attending a religious ceremony honoring the prophet muhammed's birthday. an american who helped plan the deadly 2008 attacks in mumbai, india has been sentenced to 35 years in federal prison. david headley scouted out the targets for islamist militants from pakistan. the assault killed more than 160 people, including six americans. headley could have gotten life in prison, but federal prosecutors in chicago asked for a more lenient sentence, citing his cooperation. the united nations opened a special investigation today into drone warfare. it will focus on civilian casualties resulting from strikes aimed at suspected terror cells. under president obama, the c.i.a. has stepped up drone attacks, especially in pakistan. britain and israel also use the unmanned aircraft. the u.n. report is due in october. in economic news, first-time claims for unemployment benefits hit a five-ye
it's near a key military air base and government ministries. meanwhile, president bashar al- assad was seen publicly for the first time in two weeks. state t.v. showed him attending a religious ceremony honoring the prophet muhammed's birthday. an american who helped plan the deadly 2008 attacks in mumbai, india has been sentenced to 35 years in federal prison. david headley scouted out the targets for islamist militants from pakistan. the assault killed more than 160 people, including six...
149
149
Jan 23, 2013
01/13
by
CNNW
tv
eye 149
favorite 0
quote 0
it's one of the worst state governments in the country. so if those tax dollars were buying a great efficient terrific public sector, that would be one thing. but instead, it's paying for mediocrity yet they keep asking for more and more. >> that brings me to a point. when phil mickelson was asked would you leave california or the united states because of taxes, he said i'm not sure. but you know what, when taxes get to a certain point, people start to make those decisions and it's easy to point and say you're not patriotic. maybe part of the problem is with the taxes. >> first of all, he's the gerard depardieux because he decided to leave france and go to russia. i was going to talk about notorious b.i.g. song, "mo money, mo problems." look, this is california. governor ann richards when she was governor and i was covering politics there, she would go to california to recruit companies to move to texas because of what, taxes. you have governor rick perry who sent a tweet to phil mickelson saying come on to texas. a lot of people live in t
it's one of the worst state governments in the country. so if those tax dollars were buying a great efficient terrific public sector, that would be one thing. but instead, it's paying for mediocrity yet they keep asking for more and more. >> that brings me to a point. when phil mickelson was asked would you leave california or the united states because of taxes, he said i'm not sure. but you know what, when taxes get to a certain point, people start to make those decisions and it's easy...
WHUT (Howard University Television)
116
116
Jan 24, 2013
01/13
by
WHUT
tv
eye 116
favorite 0
quote 0
in pyongyang, where the government has issued a chilling warning, claiming its nuclear weapons are designed to reach america. now, whether that's credible or not, it's certainly the most provocative statement to come since kim jong un came to power, and it's not just rhetoric in what's being referred to as a new phase in its struggle with the historic enemy. north korea says it's planning a third nuclear test. for more on that, we can join lucy williamson, who's following developments in neighboring seoul. lucy? >> thanks, george. yes, there's been months of speculation here in south korea as to whether the north was planning a third nuclear test. today we got confirmation not only that it was, but also that it was a warning to the united states. so if those u.n. sanctions this week were meant to dissuade pyongyang, they seem to have had the opposite effect. six weeks after it launched a long-range rocket and just a day after receiving extra u.n. sanctions for doing it, north korea has raised the stakes again with the news that it would carry out a third nuclear test. state television made
in pyongyang, where the government has issued a chilling warning, claiming its nuclear weapons are designed to reach america. now, whether that's credible or not, it's certainly the most provocative statement to come since kim jong un came to power, and it's not just rhetoric in what's being referred to as a new phase in its struggle with the historic enemy. north korea says it's planning a third nuclear test. for more on that, we can join lucy williamson, who's following developments in...
106
106
Jan 24, 2013
01/13
by
KQED
tv
eye 106
favorite 0
quote 0
we are in close touch with the government of algeria. we stand ready to provide assistance. we are seeking to gain a fuller understanding of what took place so we can work together with algerians and others to prevent such terrorist attacks in the future. >> ifill: clinton is expected to be back before the senate foreign relations committee tomorrow, to introduce her likely successor, senator john kerry. >> brown: online you can watch some of the more heated exchanges from the hearing, as well as read the full testimony transcript. still to come on the "newshour": the emergence of africa for u.s. policy-makers; combat roles for women in the military; the robotic planes known as drones and the way forward for the g.o.p. but first, the other news of the day. here's hari sreenivasan. >> sreenivasan: an arctic storm system kept its grip on the midwest and northeast today. sub-zero temperatures spanned a large swath of the nation, from the upper midwest into new england, and 15 states were under wind chill warnings. fierce winds have blown across the great lakes for days, dumping
we are in close touch with the government of algeria. we stand ready to provide assistance. we are seeking to gain a fuller understanding of what took place so we can work together with algerians and others to prevent such terrorist attacks in the future. >> ifill: clinton is expected to be back before the senate foreign relations committee tomorrow, to introduce her likely successor, senator john kerry. >> brown: online you can watch some of the more heated exchanges from the...
150
150
Jan 25, 2013
01/13
by
CNNW
tv
eye 150
favorite 0
quote 0
defense secretary leon panetta said the government is concerned by north korea's continuing provocative behavior and that the united states is ready to deal with it. >> the usa department issued a warning advising people not to travel to benghazi, libya. they said there's a significant potential for violence and kidnapping. >> and apple stock plunged more than 12% today. apple shares have been on the decline for months. investors are concerned about the company's prospects for growth. >> and anderson, it is cold all over. take a look at these chimps at a sanctuary in wales. they're wrapping themselves up in blankets and drinking hot tea to keep warm. don't you think of "e.t." when you see that? >> it reminds me of me on the night of the inauguration when we were cold and wrapped in the blankets. >> i think the chimps are way cuter. >> words hurt, isha. words hurt. >> not that you're not cute. >> lawsuits over an inch of a sandwich. the ridiculist is next. ♪ [ male announcer ] robitussin® liquid formula soothes your throat on contact and the active ingredient relieves your cough. robi
defense secretary leon panetta said the government is concerned by north korea's continuing provocative behavior and that the united states is ready to deal with it. >> the usa department issued a warning advising people not to travel to benghazi, libya. they said there's a significant potential for violence and kidnapping. >> and apple stock plunged more than 12% today. apple shares have been on the decline for months. investors are concerned about the company's prospects for...
81
81
Jan 24, 2013
01/13
by
WJZ
tv
eye 81
favorite 0
quote 0
it's near a key military air base and government ministries. meanwhile, president bashar al- assad was seen publicly for the first time in two weeks. state t.v. showed him attending a religious ceremony honoring the prophet muhammed's birthday. an american who helped plan the deadly 2008 attacks in mumbai, india has been sentenced to 35 years in federal prison. david headley scouted out the targets for islamist militants from pakistan. the assault killed more than 160 people, including six americans. headley could have gotten life in prison, but federal prosecutors in chicago asked for a more lenient sentence, citing his cooperation. the united nations opened a special investigation today into drone warfare. it will focus on civilian casualties resulting from strikes aimed at suspected terror cells. under president obama, the c.i.a. has stepped up drone attacks, especially in pakistan. britain and israel also use the unmanned aircraft. the u.n. report is due in october. in economic news, first-time claims for unemployment benefits hit a five-ye
it's near a key military air base and government ministries. meanwhile, president bashar al- assad was seen publicly for the first time in two weeks. state t.v. showed him attending a religious ceremony honoring the prophet muhammed's birthday. an american who helped plan the deadly 2008 attacks in mumbai, india has been sentenced to 35 years in federal prison. david headley scouted out the targets for islamist militants from pakistan. the assault killed more than 160 people, including six...
622
622
Jan 24, 2013
01/13
by
CURRENT
tv
eye 622
favorite 0
quote 0
i got to work with great staff, and it gave me a taste for what good government really can do and really whetted my appetite for it. >> jennifer: so are you going to run? >> i haven't decided yet. i'm very very serious about this. i spent time thinking about it my family and many colleagues and state holders, i am going to continue to listen for a while and then make up my mind. it's a great time for states now. we all know the problems in washington, and states can take the lead. i think massachusetts is a terrific place to show everybody what can be done by working together. >> jennifer: you are totally right that the actions can be now in the states especially with gridlock in congress. the states can be the laboratories of democracy that they should be and help to show solutions that can be spread across the country. as part of your listening tour if you will have you spoken with senator warren? >> yes, i have. she has just been wonderful. i have enjoyed watching her campaign, and now her new services as senator she has been extremely helpful to me. and i'm very grateful for it. >> j
i got to work with great staff, and it gave me a taste for what good government really can do and really whetted my appetite for it. >> jennifer: so are you going to run? >> i haven't decided yet. i'm very very serious about this. i spent time thinking about it my family and many colleagues and state holders, i am going to continue to listen for a while and then make up my mind. it's a great time for states now. we all know the problems in washington, and states can take the lead. i...
170
170
Jan 24, 2013
01/13
by
CNNW
tv
eye 170
favorite 0
quote 0
if you're a republican president or democratic president, you don't want divided government. you want a house and a senate that's in your hands. karl rove, he talked about a permanent republican majority. he was trying to set up a system where the country at least 50% would vote for a republican president, republican house, republican senate. didn't last long. so that's what you try to do. republicans love talking about ronald reagan. why? the reagan revolution. to this day they talk about him. why? from 1980 all of the way through 2000 it's been all about reagan. this is what you do. i don't understand, speaker boehner. >> what about -- so issues like gay rights which he mentioned there. what about practicality? what does this do to a lot of democrats that live in red states where people don't agree with that. they're running for re-election in 2014. >> do you vote based upon one issue or do you look at a variety of issues? same thing about the issue of choice. there are some people out there who say i am only going to vote based upon whether or not you are pro-choice or pro
if you're a republican president or democratic president, you don't want divided government. you want a house and a senate that's in your hands. karl rove, he talked about a permanent republican majority. he was trying to set up a system where the country at least 50% would vote for a republican president, republican house, republican senate. didn't last long. so that's what you try to do. republicans love talking about ronald reagan. why? the reagan revolution. to this day they talk about him....
138
138
Jan 25, 2013
01/13
by
WTTG
tv
eye 138
favorite 0
quote 0
. >> governments get their money from the taxpayers. are you asking local leaders to raise taxes to support your projects? >> we're asking them to look at a variety of capital sources and if we're looking at the exist be sources that we have and perhaps allocating some funds to metro, remember, when we create property increment and additional value, we don't get to recognize any value we create for private property developers. when we talk about the mobility benefits and cost savings we convey to the region and the fact we don't have to build 1,000 new lane miles of roads, we don't have to build 200,000 new sparking spaces at a cost of $4 billion today because metro is there, it behooves us as a region to find ways to pay for a system that can continue to support our competitiveness going forward. >> thanks for coming in tonight. >> thank you. >>> the secretary of the interior issued an order to make sure the national mall is restored. ken salazar's order calls for several long term projects between third and seventh street including ne
. >> governments get their money from the taxpayers. are you asking local leaders to raise taxes to support your projects? >> we're asking them to look at a variety of capital sources and if we're looking at the exist be sources that we have and perhaps allocating some funds to metro, remember, when we create property increment and additional value, we don't get to recognize any value we create for private property developers. when we talk about the mobility benefits and cost...